Biology 101Final ExamRules: You may use your notes, the textbook and other resources as long as these resources do not involve direct communication with anyone. Working with others on this examination is considered cheating and will result in an “F” in the course. In addition, the work should be yours. Plagiarism will also result in an “F” in the course. I will add to the questions as
...[Show More]
Biology 101
Final Exam
Rules: You may use your notes, the textbook and other resources as long as these resources do not involve direct communication with anyone. Working with others on this examination is considered cheating and will result in an “F” in the course. In addition, the work should be yours. Plagiarism will also result in an “F” in the course. I will add to the questions as the course progresses. The entire test is due on the last day of the course.
1. Explain in general terms the process of DNA replication.
2. What are the major events that occur at each stage in mitosis?
3. Compare and contrast mitosis and meiosis.
4. Explain biological magnification.
5. From an ecological point of view, how would you explain the famine in northern Africa?
6. Pick an ecological issue to discuss. Include in your discussion possible solutions to the problem.
7. Describe the factors that influence the biotic potential of a particular species.
8. If a women's father is color blind, what is the probability that her son will be color blind? What is the probability that her son's daughter will be colorblind? Color blindness is X-linked inheritance.
9. In humans, freckles are dominant to no freckles. A man with freckles is married to a woman with freckles, but the children have no freckles. What is the deal? (Assume no indiscretions have occurred).
10. Determine the protein (amino acid sequence) from the following mRNA.
5’ AUGGCUUUCCUAAUAUAACAUAUC 3’
11. Explain the difference between sex-linked and sex-influenced inheritance.
12. The inheritance pattern represented by blackened squares and circles (symbolizing the same trait in different families; see the accompanying figure) may be assumed to depend on a single autosomal dominant or a single autosomal recessive gene. (a) Indicate which is the most likely mode of inheritance for the trait. (b) Based on your answer to (a), symbolize the probable genotype for each individual in each of the four pedigrees.
Bonus: A family has 8 children, what is the probability that 4 of the children are Girls and 4 of the children are boys?
[Show Less]